Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Attraction and aversion of noctuid moths to fermented food sources coordinated by olfactory receptors from distinct gene families

BMC Biology volume 23, Article number: 1 (2025) Cite this article

Abstract

Background

Alternative food sources are crucial for the survival and reproduction of moths during nectar scarcity. Noctuid moths make a better use of fermented food sources than moths from other families, while the underlying molecular and genetic basis remain unexplored. As the fermentation progresses, yeasts lysis and the accumulation of metabolic byproducts alter the composition and the volatile release of the sugary substrates. However, it is unclear whether and how this would affect the feeding preference of moths.

Results

Here, we identified eight compounds abundant in the dynamic volatile profiles of several sugary substrates during yeast fermentation. We showed that the cotton bollworm moths were attracted to the fermented sugary substrates while being repelled when the sugary substrates were over-fermented. The attraction and aversion were respectively mediated by isoamyl alcohol and octanoic acid. We deorphanized the olfactory receptors detecting these two compounds and found that they belonged to two distinct gene families and were functionally conserved across four noctuid subfamilies; HarmOR52 orthologues responded to the attractive isoamyl alcohol and HarmIR75q.1 orthologues responded to the aversive octanoic acid.

Conclusions

Our findings suggest that this functional conservation is an olfactory adaptation that has allowed noctuid moths to extend their diet to fermented food sources.

Background

The sense of smell is of utmost importance to insects. Some of the thousands of environmental odors, including host plant volatiles, microbial odors and conspecific pheromones convey crucial information related to survival and reproduction [1,2,3,4]. In insects, volatile chemicals are detected by odorant receptors (ORs) and ionotropic receptors (IRs), both of which are mainly expressed on the dendritic membrane of olfactory sensory neurons (OSNs) on insect antennae. ORs and IRs are ligand-gated ion channels that translate the chemical signals into electrical signals which are further transmitted to higher level neuron cells and ultimately elicit a behavioral response [1, 3, 5, 6]. ORs and IRs are likely responding to distinct odor sets, with ORs detecting alcohols, aldehydes, esters and aromatics, and IRs primarily tuned to acids and amines [6,7,8]. These receptors make up the core of the olfactory system and underlie the olfactory specialization and niche adaptations of insects [3]. Both OR and IR families show high flexibility in lineage expansion and contraction following the birth-and-death model, in which gene duplication provides the possibility for evolutionary diversity and novel functions, allowing insects to adapt to the ever-changing olfactory landscape and perceive new chemical cues [2, 9, 10].

To gain fitness benefits of longevity and reproduction, adult moths need nutritional supplements before and during mating. In nature, they normally feed on sugary substances, such as flower nectar, ripe fruits, honeydew, and the outflowing sap of plants [11,12,13,14,15,16]. The majority of lepidopteran insects are nectar-feeders given that their tubular proboscis has most likely evolved to adapt to the flowering plants [17,18,19]. While in times of nectar scarcity, especially in late summer and early autumn, rotting fruits may become major food sources for some moths, mainly noctuid insects [11, 14, 20]. The rotting fruits are commonly colonized by yeasts, which can rapidly reach high densities by consuming the nutrients of the sugary substrates and release specific compounds that strongly affect the scent and chemical composition of the host fruits [21,22,23,24,25]. Yeasts mainly proliferate in the early colonization, while they begin to lyse in the later period, and the yeast-derived volatile profile changes along with that [26, 27]. Besides, byproducts from the metabolism of yeasts also contribute to the dynamic odor profiles [28, 29]. These microbial volatiles can be attractive, neutral or repellent to insects [30, 31]. However, little is known with regards to how the yeast-released odors at different fermentation stages affect the feeding preference of moths and the underlying genetic and molecular mechanisms.

Noctuidae is the most speciose families in Lepidoptera, with more than 25,000 described species [32, 33], many of which are serious agricultural pests worldwide (e.g., species from the genera Spodoptera, Heliothis and Agrotis). The development of various bait traps is important to monitor and mass trap insects for pest control. Fermented sugar-based baits, mimicry of natural food sources like rotting fruits, are the most commonly used ones to capture moths [11, 14]. In previous reports, moths caught by this type of artificial baits mainly belong to Noctuidae. For instance, El-Sayed et al. reported that over 90% of moths captured using fermented sugary baits were noctuids [34]. Likewise, Utrio sampled 4080 moth individuals using fermented sugar solution of which over 88% were noctuids [35]. Several studies have concluded that the attraction of fermented sugary baits to moths was mediated by the yeast-derived alcohols and esters [34, 36, 37]. On the other hand, toxic compounds may accumulate over fermentation and the moths should be able to recognize the signals, so as to avoid over-fermented nectar or rotting fruits that are no longer suitable food sources. However, at the molecular and genetic levels, it remains unclear why noctuid species are more attracted to fermented sugary baits than moths from other families, and how they avoid over-fermented food sources.

The brewer’s yeast Saccharomyces cerevisiae is undoubtedly one of the most common yeasts in nature and is closely linked with humans. It is usually found in the environment associated with rotting fruits and has been isolated from various sugar-based substrates, including blossom and ripe fruits [38,39,40,41]. In this study, we presented the dynamic volatile profiles of several common fruits and honey solution during S. cerevisiae fermentation process to moths and showed that the attraction and aversion responses of the cotton bollworm (Helicoverpa armigera) moths to the fermentation broth at early and later fermentation stages were mediated by isoamyl alcohol and octanoic acid respectively. We then identified and functionally characterized the olfactory receptors for these two compounds, HarmOR52 responding to isoamyl alcohol and HarmIR75q.1 to octanoic acid. Further, we investigated the orthologues of the two receptors from eight species belonging to five lepidopteran families and found that the responses to isoamyl alcohol and octanoic acid are functionally conserved across the tested noctuid species representing four noctuid subfamilies. Our experiments addressed the questions of whether, how and why fermented food sources attract noctuid moths. We propose that noctuid moths have evolved a conserved mechanism that allows them to use fermented sugary substrates as food sources, involving a noctuid-specific OR clade to detect the attractive compound isoamyl alcohol and a specialized IR75q.1 clade to perceive the aversive compound octanoic acid accumulated in the later fermentation stage.

Results

Volatile profiles of fermented sugary substrates change over time

We first analyzed the volatile samples collected from seven fermented sugary substrates at different time points (0 h, 6 h, 12 h, 1 d, 2 d and 3 d) by gas chromatography-mass spectrometry (GC/MS), including 25% honey solution, synthetic nectar and juices from five types of common fruits, apple (Malus pumila Mill.), grape (Vitis vinifera L.), watermelon (Citrullus lanatus), litchi (Litchi chinensis Sonn.) and banana (Musa nana Lour.). We found that eight common compounds were constantly present in the different substrates with relatively high content, particularly at the later fermentation stage (> 48 h of fermentation): isoamyl alcohol, phenylethyl alcohol, hexanoic acid, ethyl caprylate, octanoic acid, ethyl caprate, decanoic acid and ethyl laurate (Fig. 1, Additional file 1: Fig. S1). The scent profiles were dynamic during fermentation, which may be due to the byproducts released by yeasts at different fermentation stages (Fig. 1, Additional file 1: Fig. S1). Based on the overall odor spectra of all treatments at different time points, the whole fermentation process can be roughly divided into two stages, the early stage and the later stage, with 12 h of fermentation as a time boundary for most substrates. The isoamyl alcohol content in each treatment kept increasing since the early stage of the fermentation (0–6 h) and stayed at relatively high level until the late stage. Octanoic acid was not present in the early stage (0–12 h) in most samples; it typically showed up after 1 day of fermentation and the content was increasing at the later stage. The other major compounds released by yeasts in the later stage of fermentation included phenylethyl alcohol, some medium-chain fatty acids and corresponding esters. The 12 h and 48 h fermented honey solution, apple juice and watermelon juice were used in subsequent behavioral assays, and the amounts of isoamyl alcohol and octanoic acid identified from these samples are listed in Additional file 1: Table S1.

Fig. 1
figure 1

Volatile profiles of different substrates inoculated with S. cerevisiae yeast fermented for 12 h and 48 h. Compounds shared among different substrates produced during the fermentation process are labeled as: 1, isoamyl alcohol; 2, hexanoic acid; 3, phenylethyl alcohol; 4, ethyl caprylate; 5, octanoic acid; 6, ethyl caprate; 7, decanoic acid; 8, ethyl laurate. Native compounds from the odor collection vial were analyzed as negative control. Displayed chromatograms are representative examples of three replicates

Full size image

Attraction and aversion of H. armigera adults to fermented food sources are mediated by isoamyl alcohol and octanoic acid

We next asked how the dynamic volatile profiles of sugar-based substrates during fermentation would affect the foraging behavior of moths. To address this question, we performed two-choice Y-tube bioassays using honey solution, apple juice and watermelon juice as fermentation substrates. In the initial experiment, we tested whether the fresh juice of each substrate was attractive to H. armigera adults. Behavioral choice of females and males tested for each treatment (N ≥ 25) showed that both sexes of H. armigera adults were significantly attracted to the sugary substrates over water (Additional file 1: Fig. S2A). In another control experiment, we showed that both sexes of H. armigera were equally attracted to the cotton balls loaded with the same substrate in both arms of the Y-tube (Additional file 1: Fig. S2B).

To investigate the effect of fermentation stage on the feeding behavior of moths, honey solution, apple juice and watermelon juice inoculated with S. cerevisiae yeast were tested in the binary choice experiments after 12 h and 48 h fermentation, with the corresponding fresh juice as control. Individual female and male moths were provided the choice between fermented broth and corresponding control. Our results indicated that the 12 h fermentation broths of all the three sugary substrates were more attractive to H. armigera adults over the fresh juice, although the attraction of honey solution and watermelon juice to females was not statistically significant from control; whereas the 48 h fermentation broths of the three substrates significantly repelled both sexes of the moths (Fig. 2A).

Fig. 2
figure 2

Foraging preference of H. armigera adults in Y‐tube olfactometer assays. Behavioral responses of female and male H. armigera moths to (A) substrates inoculated with yeast fermented for 12 h and 48 h, respectively; (B) the eight individual compounds shared among different substrates produced during the fermentation; (C) isoamyl alcohol at a series of doses from 100 ng to 100 μg; (D) octanoic acid at a series of doses from 100 ng to 100 μg. The number of repetitions for each dual choice is shown on the right. Error bars indicate 95% confidence interval. P values are based on chi‐square tests: N.S., P > 0.05; *, P < 0.05; **, P < 0.01

Full size image

We further investigated whether the attraction and aversion of moths to fermentation broths at different stages were related to the eight compounds shared among different samples. Individual moths were given the choice between 10% honey solution and 10% honey solution spiked with one of the eight common compounds at a dose of 100 μg. Overall, both sexes of moths were significantly attracted to isoamyl alcohol (female: χ2 = 4.235, d.f. = 1, p = 0.0395; male: χ2 = 4.235, d.f. = 1, p = 0.0395) and repelled by octanoic acid (female: χ2 = 8, d.f. = 1, p = 0.0047; male: χ2 = 18.778, d.f. = 1, p = 0.000015), whereas moths had no significant preference or aversion to other six tested compounds (Fig. 2B). The following dose-experiment showed that isoamyl alcohol could significantly increase the attraction of 10% honey solution to both sexes of moths with a dose above 10 μg (female: χ2 = 4.5, d.f. = 1, p = 0.0339; male: χ2 = 4.235, d.f. = 1, p = 0.0396) (Fig. 2C); octanoic acid significantly reduced the attraction of 10% honey solution to males with the dose above 1 μg, and to females with the dose above 10 μg (female: χ2 = 4.667, d.f. = 1, p = 0.0308; male: χ2 = 4.5, d.f. = 1, p = 0.0339) (Fig. 2D).

Octanoic acid causes the negative effect of over-fermented broth on the reproduction of H. armigera

We investigated how the fermentation stages affect the longevity and reproduction of H. armigera adults with a series of experiments. The results indicated that neither over-fermented broths nor octanoic acid in the concentration that elicited behavioral response in binary choice experiments (100 μg) affected the longevity of both sexes of H. armigera, regardless of mating status. In contrast, H. armigera individuals fed with only water lived significantly shorter than those fed with other treatments (one-way ANOVA followed by a Tukey’s HSD test, p < 0.001 for both unmated and mated moths) (Fig. 3A, B), implying that the access to extra nutrition made a significant difference in the longevity of both female and male H. armigera.

Fig. 3
figure 3

Effect of different adult diets on the longevity and reproduction of H. armigera moths. Six treatments of adult diets were water (green dots), honey solution (orange dots), honey solution with 100 μg/mL isoamyl alcohol (blue dots), honey solution with 100 μg/mL octanoic acid (purple dots), 12 h fermented broth (burgundy dots) and 48 h fermented broth (brown dots). Longevity of (A) unmated and (B) mated female and male H. armigera fed on different adult diets (N = 15). C Mating rate (N ≥ 10), (D) lifetime fecundity (N ≥ 10) and (E) egg hatching rate (N ≥ 10) of H. armigera fed on different adult diets. Capital letters mark significant differences (P < 0.05) of six treatments based on one-way ANOVA followed by a Tukey’s HSD test. Error bars represent SEM

Full size image

On the other hand, 10% honey solution with 100 μg/mL octanoic acid and 48 h fermented broth significantly reduced the mating rate of H. armigera adults compared with those fed with 10% honey solution, 10% honey solution with 100 μg/mL isoamyl alcohol and 12 h fermented broth, showing similar mating rate with moths fed with water only. The addition of octanoic acid and over-fermentation also significantly reduced the egg hatching rate of the moths compared to those fed with other treatments (one-way ANOVA followed by a Tukey’s HSD test, p < 0.001 for both mating rate and hatching rate) (Fig. 3C, 3E). Neither addition of octanoic acid nor over-fermentation had significant effect on the fecundity of H. armigera females, the lifetime fecundity of females with access to extra nutrition was significantly higher than those fed only with water (one-way ANOVA followed by a Tukey’s HSD test, p < 0.001) (Fig. 3D).

Noctuid specific HarmOR52 orthologues responded primarily to the attractive isoamyl alcohol

Further, we looked for the olfactory receptor genes that were responsible for the respective attraction and aversion responses of the moths to isoamyl alcohol and octanoic acid. In the phylogenetic tree of lepidopteran ORs based on 519 ORs from nine lepidopteran species (five Noctuidae, one Bombycidae, one Crambidae, one Tortricidae and one Plutellidae (Fig. 4A), we noticed a small clade that is formed by ORs from noctuid species exclusively (highlighted as HarmOR52 clade in the tree), with pairwise amino acid identities among the orthologues ranging from 72.8% to 89.3% (Additional file 1: Table S2). We recently deorphanized one of the orthologues in the turnip moth Agrotis segetum, AsegOR17, which strongly responded to isoamyl alcohol, with the structurally related compound pentanol as the secondary ligand [42]. This made us to predict that the response to isoamyl alcohol was conserved in this orthologous group. Therefore, we expressed the other orthologues within the clade along with corresponding Orco in Xenopus oocytes and tested against a panel of seven alcohols. All receptors from this clade exhibited similar response profiles, with isoamyl alcohol as the primary ligand and pentanol as the secondary ligand at the dose of 100 μM (Fig. 5). The responses of each receptor to isoamyl alcohol and pentanol were dose-dependent, with a higher sensitivity to isoamyl alcohol compared to pentanol (Fig. 5).

Fig. 4
figure 4

Phylogenetic relationship of ORs and IRs in Lepidoptera. A The maximum‐likelihood phylogenetic tree was based on the protein sequence alignments of odorant receptors (ORs) from H. armigera (Noctuidae, branches coloured in dark blue), A. segetum (Noctuidae, green), Spodoptera frugiperda (Noctuidae, pink), Mythimna separata (Noctuidae, red), Bombyx mori (Bombycidae, orange), Ostrinia furnacalis (Crambidae, purple), Cydia pomonella (Tortricidae, brown), Plutella xylostella (Plutellidae, light blue) and Spodoptera littoralis (Noctuidae, black). The Orco clade was used as an outgroup. The relationship of receptors within HarmOR52 clade is shown in detail. The large lineage in which HarmOR52 clade is included is marked with a blue dot. B The maximum‐likelihood phylogenetic tree was based on the protein sequence alignments of ionotropic receptors (IRs) of species mentioned above. The tree was rooted with the lineage of IR8a and IR25a receptors. The relationship of receptors within IR75q.1 clade is shown in detail

Full size image
Fig. 5
figure 5

HarmOR52 orthologues from Noctuidae responded primarily to isoamyl alcohol. Left panel of each receptor: Response profile of the receptor to the different odors. Response magnitudes were normalized to the average response of primary ligand (N ≥ 4). Error bars indicate the SEM. Middle panel of each receptor: Dose‐dependent responses, showing values normalized to the average response of the most active compound at 1 mM (N ≥ 4 for each ligand). Right panel of each receptor: Representative current trace of oocytes upon successive exposures to 100 μM stimuli. Each compound was applied at the time indicated by the arrowheads for 10 s. Individual data values are listed in Additional file 3

Full size image

The responses of IR75q.1 orthologues to the aversive octanoic acid were conserved in noctuids

We previously reported that the ionotropic receptor AsegIR75q.1 primarily responded to octanoic acid followed by nonanoic acid in A. segetum [8]. In the phylogenetic tree of lepidopteran IRs based on 221 IRs from above mentioned eight lepidopteran species (Fig. 4B), the highlighted Lepidoptera-specific IR75q.1 clade was formed by IRs from seven of the eight species since the IR75q.1 is missing in the diamondback moth Plutella xylostella. Receptors grouped in the IR75q.1 clade share a higher pairwise amino acid identity within Noctuidae (64.9% to 78.9%) than that across families (43.8% to 51.3%) (Additional file 1: Table S3).

To investigate whether and at which taxonomic level the response to octanoic acid by IR75q.1 orthologues is conserved, the seven IRs from this clade were co-expressed with corresponding IR8a in Xenopus oocytes and tested against eight medium-chain fatty acids. Oocytes co-expressing AsegIR75q.1/AsegIR8a, HarmIR75q.1/HarmIR8a, MsepIR75q.1/MsepIR8a and SfruIR75q.1/SfruIR8a showed similar response profiles, with a primary response to octanoic acid and a much weaker response to nonanoic acid at the concentration of 10 μM. Minor but clear responses were elicited also by the structurally similar compounds heptanoic acid and decanoic acid. The responses of the four IRs to octanoic acid and nonanoic acid were dose-dependent, with a threshold concentration at 1 μM (Fig. 6). Oocytes co-expressing OfurIR75/OfurIR8a responded strongly with similar magnitudes to pentanoic acid and hexanoic acid in the screening assays. Weaker responses were elicited by heptanoic acid and octanoic acid. Dose–response also indicated similar sensitivity of OfurIR75 to the two primary ligands (Fig. 6). In addition, no response was recorded from the oocytes co-injected with BmorIR75q.1/BmorIR8a and CpomIR75q.1/CpomIR8a in the screening experiments.

Fig. 6
figure 6

IR75q.1 orthologues responded to octanoic acid and other medium‐chain fatty acids. Left panel of each receptor: Response profile of the receptor to the different odors. Response magnitudes were normalized to the average response of primary ligand (N ≥ 4). Error bars indicate the SEM. Middle panel of each receptor: Dose‐dependent responses, showing values normalized to the average response of the most active compound at 1 mM (N ≥ 4 for each ligand). Right panel of each receptor: Representative current trace of oocytes upon successive exposures to 10 μM stimuli. Each compound was applied at the time indicated by the arrowheads for 10 s. Individual data values are listed in Additional file 3

Full size image

Discussion

In this study, we demonstrated that the odor profiles of fermented sugary substrates were dynamic in terms of the occurrence time and relative contents during fermentation. Among the eight common yeast-released compounds in all the fermented substrates, isoamyl alcohol appeared since the early stage (within 12 h) and accumulated over time as a metabolic product of the Ehrlich pathway using leucine and phenylalanine as precursors [29]. The other seven compounds, including the medium-chain fatty acid, octanoic acid, were mostly accumulated in the later fermentation stage (after 12 h). However, yeast fermentation rates are affected by several factors, including but not limited to temperature, pH value, content and type of sugars and amino acids in sugary substrates [29]. In our experiments, we took 12 h fermentation as the time boundary because in most samples isoamyl alcohol was the dominant yeast-derived compound before 12 h fermentation. The medium-chain fatty acids are metabolic by-products of yeasts and are then esterified to corresponding esters. They, especially octanoic acid and decanoic acid, are toxic to yeasts and promote cell death although they are generated from yeasts, which limits the yeast population growth in the later fermentation stage [43]. Consumption and degradation of sugars and amino acids explain the presence of these compounds, while the amounts present are defined by the growth rate and cell cycle of yeasts which are largely affected by the environmental nutrients [44].

We found that the changes in volatile profiles of fermented sugary substrates affected the feeding preference of moths, with the 12 h fermentation cultures being more attractive to adult H. armigera than the fresh juices, while the 48 h fermentation cultures were significantly less attractive. The attraction and aversion elicited by the fermentation cultures in different stages were primarily mediated by isoamyl alcohol and octanoic acid. This is in line with the previous reports that isoamyl alcohol-based baits are highly attractive to noctuid moths and have been used in field traps [36, 45,46,47,48], and octanoic acid, by contrast, is highly toxic and repellent to many insects, including but not limited to flies, mosquitos, ants, bees and moths [8, 49,50,51,52]. Although the fermentation substrates we used in this study release some other volatiles, the consistent results we obtained from GC/MS and Y-tube bioassays collectively suggested that these compounds would not influence the outcomes of the binary choice experiments.

Isoamyl alcohol is one of the main yeast-released compounds throughout the fermentation process, and its high volatility allows moths to track the fermented sugary sources over long distance [11, 14, 47, 48]. Our Y-tube bioassays indicated that isoamyl alcohol is the only compound among the tested volatiles that can elicit attraction in H. armigera adults. As such, the ability of noctuid moths to detect isoamyl alcohol is a prerequisite for them to use fermented sugary substrate as food source. While isoamyl alcohol functions as an indicator of fermented food sources to moths, the repellency of octanoic acid against moths is probably due to its negative effect on their reproduction. The addition of octanoic acid would not affect the longevity and fecundity of moths but can significantly reduce the mating rate and egg hatching rate. Some previous studies indicated that octanoic acid is toxic and lethal to arthropods. For instance, Legal and Plawecki reported that octanoic acid is lethal to a number of insects with varied LD50 [49]. Likewise, topical administration of octanoic acid on the cuticle of Galleria mellonella adults and larvae would damage their main defense systems [53]. In our study, the fact that octanoic acid did not impair the longevity of H. armigera adults may be due to the relatively low amount used in the experiment compared with the insects’ body mass, although it is enough to affect their reproduction. Further studies are needed to address the questions of why and how octanoic acid intake affects the mating behavior of moths. As one of the major by-products of yeasts in the later fermentation stage, the presence of octanoic acid in relatively high content indicates the low quality of food nutrients, and more importantly, intake of this compound has a negative effect on the mating behavior of noctuid moths. Hence, octanoic acid functions as a kind of “stop code” for noctuid moths toward fermented food sources, which is supported by the repellent effect of this compound to both sexes of H. armigera and A. segetum [8].

We unveiled the molecular mechanisms behind the phenomenon that fermented food sources are more attractive to noctuids than moths from other families. We identified the HarmOR52 clade formed exclusively by the orthologues from noctuid species representing four subfamilies of Noctuidae, including AsegOR17, HarmOR52, MsepOR8, SfruOR36 and SlitOR36. In previous studies, HarmOR52 and SlitOR36 were reported as broadly-tuned receptors showing the strongest response to benzyl alcohol whereas isoamyl alcohol was not included among the tested compounds [19, 54]; AsegOR17 showed the strongest response to isoamyl alcohol, followed by pentanol and benzyl alcohol [42]. Here we included both isoamyl alcohol and benzyl alcohol in the panel of tested compounds and demonstrated the functional conservation of the noctuid-specific HarmOR52 clade, with four assayed orthologues being most sensitive to isoamyl alcohol and showing weaker response to benzyl alcohol, which is in line with the previous studies.

The attraction to isoamyl alcohol is mediated by an OR, while the aversion of octanoic acid is mediated by a member in the other olfactory receptor gene family, the IRs. Of the seven orthologues clustered with the previously characterized octanoic acid receptor AsegIR75q.1 [8], the ones from the four noctuid species have preserved their functions, responding primarily to octanoic acid, whereas those from other moth families exhibit divergent ligand profiles. OfurIR75 (Pyralidae) was tuned to pentanoic acid and hexanoic acid, BmorIR75q.1 (Bombycidae) and CpomIR75q.1 (Tortricidae) showed no response to the tested medium-chain fatty acids, while IR75q.1 orthologue was missing in the Plutellidae species P. xylostella. Orthologous receptors are typically assumed to perform equivalent or similar functions across species since they are derived from a single ancestral gene, especially in closely related species [55,56,57]. For instance, the flower odor phenylacetaldehyde is detected by functionally conserved OR orthologues from eleven species across the Glossata suborder [19]. Likewise, the ecologically relevant odor 2-phenylethanol and several green leaf volatiles are perceived by two groups of OR orthologues in three beetle species of the Curculionidae (weevil) family [58]. However, the functions of receptors may change over extended evolutionary history along with the species- or taxon-specific odor set, resulting in the functional divergence among receptor orthologues [19, 54, 59]. In our case, the functional conservation of IR75q.1 in noctuid species clearly correlates with the ecological importance of octanoic acid to noctuids. Although medium-chain fatty acids, in particular octanoic acid, is toxic to many insects, certain species are able to benefit from detecting this compound. For instance, octanoic acid is abundant in Morinda citrifolia and toxic even lethal to most drosophilids, however, Drosophila sechellia is a specialist species on Morinda fruits by evolving physiological adaptation to this compound [60, 61]. In another instance involving mosquitoes, medium-chain fatty acids, especially C8-C10 acids, are capable of repelling mosquitos either individually or when combined. Nevertheless, when present in human sweat they significantly increase the attractiveness of human body odor to mosquitos [62,63,64].

We briefly summarize the receptor-ligand correspondence in the lepidopteran species in Fig. 7, which shows that the responses to isoamyl alcohol and octanoic acid are conserved across the studied noctuid species representing four common subfamilies. It appears that the noctuid species have evolved a clade of ORs which is not present in other lepidopteran families investigated in this study to recognize isoamyl alcohol. IR75q.1 is commonly present in most of the studied species except P. xylostella (Plutellidae) and shows functional conservation within the Noctuidae but functional divergence between lepidopteran families. We only tested one OR and one IR from each species. However, moths detecting odorants follow a combinatory coding strategy with each receptor being activated by several ligands and a specific ligand activating several receptors [2]. In this study, our attempts of gene knock-out experiments were not successful although we have previously demonstrated our competence with CRISPR/Cas9 and successfully knocked out many genes in H. armigera [19, 65, 66]. We assign the unsuccessful attempts in the present study to the presence of two highly similar sequences of HarmIR75q.1 with 98.958% amino acid identity on chromosome 02. Due to the lack of electrophysiological and behavioral data in moths with mutant backgrounds, we could not exclude the possibility that there may be other receptors responding to these two compounds. However, based on the consistence of phylogenetic analysis, receptor functions and related behavioral experiments, we can clearly make the connection between the dietary adaptation of noctuid moths to fermented food sources and the functions of HarmOR52 orthologues and IR75q.1 orthologues.

Fig. 7
figure 7

Functional conservation of isoamyl alcohol ORs and octanoic acid IRs in the tested Noctuid moths. Species tree of H. armigera, A. segetum, S. frugiperda, M. separata, B. mori, O. furnacalis, C. pomonella and P. xylostella was built using the maximum likelihood method with concatenated protein sequences of 1524 single-copy orthologous genes with Anopheles gambiae and Stenopsyche tienmushanensis as outgroup. Grey dots mark nodes with high support values (over 0.9). Color codes indicate the investigated species from different families. The primary ligands of receptors from Noctuidae are highlighted in blue

Full size image

Conclusions

To maximize the survival and reproduction benefits, insects constantly adapt to new ecological environments and adjust their olfactory repertoire accordingly. Novel relationships between external new signals and internal olfactory neurons may evolve, either by gene duplication, producing new receptors with novel properties or by modifying the specificities of the ancestral receptors. The ORs from HarmOR52 clade have evolved conserved responses to aliphatics, with isoamyl alcohol as best ligand, allowing noctuids to locate fermented food sources over long distance. At the same time, noctuid moths evolved IR75q.1 to detect octanoic acid, providing a mechanism to avoid attraction to over-fermented food sources that contain high amounts of medium-chain fatty acids with negative effect on survival and reproduction. In conclusion, noctuid moths have evolved a conserved combination of receptors detecting isoamyl alcohol and octanoic acid mediating attraction and aversion, which allows them to successfully exploit fermented sugary substrates during nectar scarcity.

Methods

Chemicals

The sources of compounds used in this study are listed in Additional file 1: Table S4. Stock solutions for Xenopus oocyte recordings were prepared by dissolving each compound to 100 mM in dimethyl sulfoxide (DMSO) solvent and stored at − 20 °C. Before each experiment, the stock solutions were diluted to desired concentration in Ringers’ buffer (96 mM NaCl, 2 mM KCl, 5 mM MgCl2, 0.8 mM CaCl2, 5 mM HEPES, pH 7.6) with the final stimuli containing 0.1% DMSO. Ringers’ buffer containing 0.1% DMSO was used as negative control in the recordings. Stock solutions for behavioral experiments were prepared by dissolving the neat compounds to 10 mg/mL in acetone and were stored at − 20 °C. The amount used in each experiment depended on the specific experimental needs.

Insects

The H. armigera used in the experiments were laboratory strain from the Institute of Plant Protection of the Chinese Academy of Agricultural Sciences in Beijing, China. The larvae of H. armigera were reared on an artificial diet [67], under the conditions of 16L:8D photoperiod, 65% relative humidity and a temperature of 27 ℃. The pupae were sexed and kept separately and emerged adults were fed with 10% honey solution.

Fermentation trials

The fruits (apples, grapes, watermelons, litchis and bananas) were purchased in a local supermarket (Beijing, China). They were all ripe, undamaged and visually good in color and texture. To prepare the juice, the fruits were washed, peeled and crushed using a sterilized squeezer. Fresh juice was prepared in each experiment. Honey used in this study was a gift from the Institute of Apicultural Research, Chinese Academy of Agricultural Science. 25% (W/V) honey solution was prepared to conduct the fermentation trials. Synthetic nectar was prepared by 30% (W/V) sucrose solution (in Milli-Q water) supplemented with 3.16 mM casamino acids (OmniPur CAS 65072–00–6).

The fermentation trials were carried out using 50 mL of fruit juice, 25% honey solution or synthetic nectar in 100 mL Erlenmeyer flask, yeast cells were inoculated into each sample at a concentration of about 900 cells/μL. S. cerevisiae used in this study was purchased from the Angel Yeast company. Prior to inoculation, the yeast cells were dissolved in sterilized Milli-Q water and activated by 30 min of incubation at 37 °C, and the yeast cell population was determined by a hematocytometer. Erlenmeyer flasks were sealed with breathable parafilm and incubated statically at 29 °C. Volatile compounds of samples were collected and analyzed at 0 h, 6 h, 12 h, 24 h, 48 h and 72 h after incubation.

Collection and analysis of volatile compounds

Volatile compounds from the treatments and controls were collected and analyzed using headspace solid phase micro-extraction and gas chromatography-mass spectrometry (HS-SPME-GC/MS). In detail, 5 mL of fermentation culture was transferred to a 20 mL glass vial, and a 50/30 μm divinylbenzene/carboxen/polydimethylsioxane coated fiber (Supelco, Bellefonte, USA) was inserted into the vial from the top rubber cap and suspended at a distance of 1 cm from the sample surface. Prior to each extraction, the fiber was aged in the GC inlet port at 260 °C for 25 min at 1 mL/min in order to remove the residuals. Each sampling lasted for 50 min at 40 °C before the analysis by GC/MS.

Samples were subsequently analyzed using a GC/MS QP2020 (Shimadzu, Tokyo, Japan) with a Rtx-5MS column (30 m × 0.25 mm × 0.25 μm, Shimadzu, Tokyo, Japan) based on the following oven temperature program: 42 °C for 4 min, then increased to 90 °C at a rate of 10 °C/min, held 2 min, then increased to 130 °C at a rate of 8 °C /min and held for 2 min, then increased to 240 °C at a rate of 10 °C /min and held for 5 min. The injector port was kept at 250 °C and helium was used as carrier gas at a flow rate of 1 mL/min. Synthetic compounds were used as an external standard to confirm the target compounds.

Two-choice experiments using a Y-tube olfactometer

Behavioral responses of H. armigera adults were assessed using a Y-tube olfactometer consisting of a 14 cm main arm with an insect introduction chamber attached and two 14 cm long “Y” arms with an interior angle of 120° for the stimulus and control odors. The inner diameter of the Y-tube is 1.8 cm. The tests were always conducted in a dark room under red light illuminating the olfactometer from above (~ 26 Lux) during the first 4 h of the scotophase at the following experimental conditions: 26 °C air temperature, 55% relative humidity, and 0.8 L/min airflow. The experiments were performed following the previously described method [8]. 1 mL of each treatment and control compound were separately loaded on two cotton balls which were left for 15 min before tests for solvent evaporation and then placed inside the ends of the Y-arms. The Y-tube and cotton balls were renewed after every 10 tests. 16–20 h starved naive male/female moths, 2–3 days old, were used in the bioassay. Individual adults of H. armigera were released from the introduction chamber at the end of main arm. H. armigera adults were considered to have made a choice only when they entered either of the arms and fed on the cotton ball within 5 min. By contrast, during the observation period (5 min), if the insect kept moving back and forth or stayed in the main arm without movement, it was considered as no choice had been made.

Pre-experiments were performed to test individually whether the fresh apple juice, watermelon juice and 25% honey solution are attractive to the H. armigera adults. Cotton ball loaded with I mL water was used as control (N ≥ 25 for each substrate and each sex). Side preference was checked by another control experiment (cotton balls loaded with 1 mL 10% honey solution with 10 μL acetone were placed at both sides of Y-tube).

In the bioassay, we initially tested the effects of different fermentation stages (12 h and 48 h after inoculation with S. cerevisiae yeast) of apple juice, watermelon juice, and 25% honey solution on the behavior of H. armigera adults. Fermented samples were prepared following the protocol described in fermentation trials and corresponding fresh juice was used as control. The eight common compounds that are in relative high content in fermented samples were individually assayed using the Y-tube olfactometer. Stock solutions of these compounds were prepared by dissolving the neat compounds to 10 mg/mL in acetone. Before each experiment, 10 μL stock solution was mixed in 1 mL 10% honey solution, then the mixture was loaded on a cotton ball. 10% honey solution with 10 μL acetone was used as control. After the screening-tests, isoamyl alcohol and octanoic acid were tested at a series of doses in tenfold increments from 100 ng to 100 μg. The proportions of no choice for each treatment and each sex were lower than 5% and these moths were excluded from the statistical analysis. Chi-square tests were used to compare the observed and expected frequencies of the responding moths.

Longevity and reproductive capacity of H. armigera adults fed with different substrates

To measure the effect of different substrates on the longevity and the reproductive success of H. armigera adults, six nutritional treatments were assigned, including water, 10% honey solution, 10% honey solution with isoamyl alcohol (100 μg /mL), 10% honey solution with octanoic acid (100 μg /mL), 25% honey solution fermented for 12 h (12 h fermented broth) and 48 h (48 h fermented broth). Moths used in this experiment were sexed at pupae stage and females and males were kept separately. On the day of eclosion and after sclerotization of the wings, moths were transferred individually into 50 mL transparent plastic cups covered with gauze and fed daily with different substrates loaded on small cotton balls.

Two-day-old females and 1-day-old males were randomly paired in transparent plastic cups (500 mL, 8 cm in diameter and 10 cm in height) covered with gauze for mating and oviposition. The mating behavior was video recorded with a Sony MiniDV Camcorder for 12 h from 8:00 pm to next day 8:00 am under infrared lighting (not visible for moth) at 25 °C and 55% RH. Ten pairs were recorded as a group and the mating percent of each group was determined from the video. Ten groups were recorded for each treatment.

For the longevity experiment, unmated and mated moths were assayed, the small cotton balls soaked with different substrates were renewed daily, and the survival of the adult moths in the cups was recorded every day until death (N = 15 for each treatment).

Female fecundity and egg hatching rate were also investigated. Mated moths obtained from the mating experiments were kept in pairs in plastic cups covered with gauze on which the females laid eggs. The cups and gauze cavers were replaced daily and the number of eggs on each piece of gauze was counted every day until the moths dead. The total number of eggs laid by a single female represents its lifetime fecundity. Corresponding substrates were provided to different treatment groups for nutrition. Over 10 replicates for each treatment were recorded. The gauze covers with eggs were then kept in an insect rearing chamber (26 ± 1 °C, 60 ± 5% RH), and the eggs which could develop to black head stage were considered as hatchable eggs [68]. The percentage of eggs that developed to the black head stage was recorded and calculated to represent the egg hatching rate.

Pairwise differences of longevity and reproduction characteristics between each treatment and control were determined by one-way ANOVA followed by a Tukey’s HSD test using IBM SPSS Statistics 28.0.

Phylogenetic analysis

The phylogenetic relationships of lepidopteran ORs and IRs respectively, were analyzed based on the amino acid sequences of 458 ORs and 221 IRs from H. armigera (Noctuidae, Heliothinae) [69, 70], A. segetum (Noctuidae, Noctuinae) [8, 42], Spodoptera frugiperda (Noctuidae, Amphipyrinae) [70, 71], Mythimna separata (Noctuidae, Hadeninae) [72], Bombyx mori (Bombycidae) [73, 74], Ostrinia furnacalis (Pyralidae) [75], Cydia pomonella (Tortricidae) [76] and P. xylostella (Plutellidae) [70, 77]. 61 ORs from Spodoptera littoralis were also included in the OR tree, because this species is a model for olfaction study in moths with many ORs have been deorphanized [54]. The sequence alignment was performed using ClustalW, implemented in Geneious software package 9.1.8 (Biomatters Ltd. Auckland, New Zealand). To improve the alignment and to ensure the quality of the tree, short sequences (< 300 amino acids for ORs and < 400 amino acids for IRs) were excluded. Both OR and IR trees were built based on the maximum-likelihood method using MEGA X with the WAG + G + F substitution model. The OR tree was rooted with the Orco lineage and IR tree was rooted with the IR8a and IR25a receptor lineage.

The species tree of H. armigera [78], A. segetum [79], S. frugiperda [80], M. separata [81], B. mori [82], O. furnacalis [83], C. pomonella [84], and P. xylostella [85] was constructed using maximum-likelihood method with concatenated protein sequences of 1524 single-copy orthologous genes with branch support calculated by rapid bootstrapping (N = 1000). Anopheles gambiae [86], and Stenopsyche tienmushanensis [87] were used as outgroup. All trees were visualized and color coded using FigTree 1.4.4.

Functional characterization in Xenopus oocytes

Full-length sequences of target genes, including HarmIR8a, HarmIR75q.1, HarmOrco and HarmOR52 orthologues in H. armigera, A. segetum, M. separata, S. frugiperda, B. mori, O. furnacalis, C. pomonella and P. xylostella were PCR amplified from the antennal cDNA of both female and male adults of each species using gene-specific primers containing flanking 5´ homologous arm (TTGCAGGATCCCATCGATTC) + restriction site (EcoR I “GAATTC”) + Kozak sequence (GCCACC) and 3´ homologous arm (GACTCACTATAGTTCTAGAGG) + restriction site (Xho I “CTCGAG”). The nucleotide sequences and amino acid sequences of ORs and IRs are available in Additional file 2. The amplified genes were sub-cloned into the pCS2 + expression vectors using ClonExpress II One Step Cloning Kit (Vazyme Nanjing, China). All DNA sequences were verified by sequencing by the company Tsingke Biotechnology (Beijing, China). The sequences of the genes investigated in this study were attached in the supplementary material and the specific primers of all genes are listed in Additional file 1: Table S5. Large quantities of plasmids containing verified sequences were obtained using the PureLinkTM HiPure Plasmid Filter Midiprep Kit (Thermo Fisher Scientific). The caped RNAs (cRNAs) of target receptors were synthesized from Not I (Thermo Fisher Scientific) linearized recombinant pCS2 + plasmids using the mMESSAGE mMACHINE SP6 transcription kit (Thermo Fisher Scientific).

Each of the candidate genes was co-expressed with corresponding co-receptor in Xenopus laevis oocytes, and two-electrode voltage clamp recordings were performed following the previously described protocols [88, 89]. In brief, oocytes were surgically collected from ovarian tissue of X. laevis and treated with 2 mg/mL collagenase type I in washing buffer (96 mM NaCl, 2 mM KCl, 5 mM MgCl2 and 5 mM HEPES, pH 7.6) for 40 min at 27 ℃. Mature healthy oocytes (stages V–VII) were co-injected with 27.6 ng each of specific receptor and corresponding co-receptor (ORs were co-expressed with Orco and IRs were co-expressed with IR8a) cRNAs, then incubated for 2–5 days at 18 ℃ in Ringer’s buffer containing 5% dialyzed horse serum, 50 mg/L tetracycline, 100 mg/L streptomycin and 550 mg/L sodium pyruvate. Afterwards, two-electrode voltage clamp technique was used to record the ligand-induced whole-cell inward currents from oocytes in good condition at a holding potential of − 80 mV. Injected oocytes were exposed to tested compounds in a random order and the data were collected and analyzed using Digidata 1440A and Pclamp10.0 software (Axon Instruments Inc., Union City, CA, USA). In oocyte screening experiments, the stimulus concentration used for ORs was 100 μM and 10 μM for IRs. Using the lower concentration for IRs was mainly due to the exceptionally strong responses of oocytes expressing IRs to octanoic acid.

Data availability

All data generated or analyzed during this study are included in this published article and its supplementary information files. The raw mass spectrometry data generated in current study are available on figshare, https://figshare.com/articles/dataset/GC_MS_raw_data/27899820 (DOI:https://doiorg.publicaciones.saludcastillayleon.es/10.6084/m9.figshare.27899820). The nucleotide sequences and amino acid sequences of ORs and IRs tested using oocyte recordings are available in additional file 2. The individual data values of Fig. 5 and Fig. 6 are available in additional file 3.

Abbreviations

ORs:

Odorant receptors

IRs:

Ionotropic receptors

Orco:

Odorant receptor co-receptor

OSNs:

Olfactory sensory neurons

DMSO:

Dimethyl sulfoxide

GC/MS:

Gas chromatography-mass spectrometry

HS-SPME-GC/MS:

Headspace solid phase micro-extraction and gas chromatography-mass spectrometry

cRNA:

Caped RNA

References

  1. Hansson BS, Stensmyr MC. Evolution of insect olfaction. Neuron. 2011;72:698–711. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.neuron.2011.11.003.

    Article  PubMed  Google Scholar 

  2. Andersson MN, Löfstedt C, Newcomb RD. Insect olfaction and the evolution of receptor tuning. Front Ecol Evol. 2015;3:53. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fevo.2015.00053.

    Article  Google Scholar 

  3. Fleischer J, Pregitzer P, Breer H, Krieger J. Access to the odor world: olfactory receptors and their role for signal transduction in insects. Cell Mol Life Sci. 2018;75(3):485–508. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00018-017-2627-5.

    Article  PubMed  Google Scholar 

  4. Kandasamy D, Gershenzon J, Andersson MN, Hammerbacher AV. Volatile organic compounds influence the interaction of the Eurasian spruce bark beetle (Ips typographus) with its fungal symbionts. ISME J. 2019;13:1788–800. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41396-019-0390-3.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Clyne PJ, Warr CG, Freeman MR, Lessing D, Kim J, Carlson JR. A novel family of divergent seven-transmembrane proteins: candidate odorant receptors in Drosophila. Neuron. 1999;22(2):327–38. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/S0896-6273(00)81093-4.

    Article  PubMed  Google Scholar 

  6. Benton R, Vannice KS, Gomez-Diaz C, Vosshall LB. Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila. Cell. 2009;136(1):149–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cell.2008.12.001.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Abuin L, Bargeton B, Ulbrich MH, Isacoff EY, Kellenberger S, Benton R. Functional architecture of olfactory ionotropic glutamate receptors. Neuron. 2011;69(1):44–60. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.neuron.2010.11.042.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Hou XQ, Zhang DD, Powell D, Wang HL, Andersson MN, Löfstedt C. Ionotropic receptors in the turnip moth Agrotis segetum respond to repellent medium-chain fatty acids. BMC Biol. 2022;20:34. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12915-022-01235-0.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Nei M, Niimura Y, Nozawa M. The evolution of animal chemosensory receptor gene repertoires: roles of chance and necessity. Nat Rev Genet. 2008;9:951–63. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nrg2480.

    Article  PubMed  Google Scholar 

  10. Benton R. Multigene family evolution: perspectives from insect chemoreceptors. Trends Ecol Evol. 2015;30(10):590–600. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.tree.2015.07.009.

    Article  PubMed  Google Scholar 

  11. Norris MJ. The feeding habits of adult Lepidoptera Heteroneura. Trans Roy Entomol Soc Lond. 1936;85:61–90. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1365-2311.1936.tb00239.x.

    Article  Google Scholar 

  12. Gilbert LE, Singer MC. Butterfly ecology. Annu Rev Ecol S. 1975;6:365–95. https://www.annualreviews.org/doi/pdf/10.1146/annurev.es.06.110175.002053.

  13. Nishio N. Honeydew as food resources for moths. Jpn Heterocerists’ J. 1986;139:220–3.

    Google Scholar 

  14. Süssenbach D, Fiedler K. Noctuid moths attracted to fruit baits: Testing models and methods of estimating species diversity. Nota Lepid. 1999;22(2):115–54.

    Google Scholar 

  15. Sugiura S, Yamazaki K. Migratory moths as dispersal vectors of an introduced plant-pathogenic fungus in Japan. Biol Invasions. 2007;9:101–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s10530-006-9006-8.

    Article  Google Scholar 

  16. Sakagami K, Sugiura S. A diverse assemblage of moths feeding on aphid honeydew. J Asia-Pac Entomol. 2018;21:413–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.aspen.2018.01.019.

    Article  Google Scholar 

  17. Krenn HW. Feeding mechanisms of adult Lepidoptera: structure, function, and evolution of the mouthparts. Annu Rev Entomol. 2010;55:307–27. https://doiorg.publicaciones.saludcastillayleon.es/10.1146/annurev-ento-112408-085338.

    Article  PubMed  PubMed Central  Google Scholar 

  18. Schiestl FP. The evolution of floral scent and insect chemical communication. Ecol Lett. 2010;13(5):643–56. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1461-0248.2010.01451.x.

    Article  PubMed  Google Scholar 

  19. Guo M, Du L, Chen Q, Feng Y, Zhang J, Zhang X, et al. Odorant receptors for detecting flowering plant cues are functionally conserved across moths and butterflies. Mol Biol Evol. 2021;38(4):1413–27. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/molbev/msaa300.

    Article  PubMed  Google Scholar 

  20. Wood AA. A new bait trap for noctuid moths. Can Entomol. 1931;7:149–50. https://doiorg.publicaciones.saludcastillayleon.es/10.4039/Ent63149-7.

    Article  Google Scholar 

  21. Becher PG, Flick G, Rozpędowska E, Schmidt A, Hagman A, Lebreton S, et al. Yeast, not fruit volatiles mediate Drosophila melanogaster attraction, oviposition and development. Funct Ecol. 2012;26:822–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1365-2435.2012.02006.x.

    Article  Google Scholar 

  22. Herrera CM, de Vega C, Canto A, Pozo MI. Yeasts in floral nectar: a quantitative survey. Ann Bot. 2009;103:1415–23. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/aob/mcp026.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Lievens B, Hallsworth JE, Pozo MI, Belgacem ZB, Ben Stevenson A, Willems KA, et al. Microbiology of sugar-rich environments: diversity, ecology and system constraints. Environ Microbiol. 2015;17:278–98. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1462-2920.12570.

    Article  PubMed  Google Scholar 

  24. Pozo MI, Lievens B, Jacquemyn H. Impact of microorganisms on nectar chemistry, pollinator attraction and plant fitness. In: Peck RL, editor. Nectar: Production, Chemical Composition and Benefits to Animals and Plants. New York: Nova Science Publishers; 2015. p. 1–45.

    Google Scholar 

  25. Sobhy IS, Baets D, Goelen T, Herrera-Malaver B, Bosmans L, den Ende WV, et al. Sweet scents: nectar specialist yeasts enhance nectar attraction of a generalist aphid parasitoid without affecting survival. Front Plant Sci. 2018;9:1009. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fpls.2018.01009.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Babayan TL, Bezrukov MG. Autolysis in yeasts. Acta Biotechnol. 1985;5:129–36. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/abio.370050205.

    Article  Google Scholar 

  27. Biasazin TD, Herrera SL, Kimbokota F, Dekker T. Diverging olfactory sensitivities to yeast volatiles reflect resource partitioning of tephritids and drosophilids. Front Ecol Evol. 2022;10:999762. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fevo.2022.999762.

    Article  Google Scholar 

  28. Korpi A, Järnberg J, Pasanen AL. Microbial volatile organic compounds. Crit Rev Toxicol. 2009;39:139–93. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/10408440802291497.

    Article  PubMed  Google Scholar 

  29. Dzialo MC, Park R, Steensels J, Lievens B, Verstrepen KJ. Physiology, ecology and industrial applications of aroma formation in yeast. FEMS Microbiol Rev. 2017;41(Supp_1):S95–128. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/femsre/fux031.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Schulz S, Dickschat JS. Bacterial volatiles: the smell of small organisms. Nat Prod Rep. 2007;24:814–42. https://doiorg.publicaciones.saludcastillayleon.es/10.1039/b507392h.

    Article  PubMed  Google Scholar 

  31. Leroy PD, Sabri A, Heuskin S, Thonart P, Lognay G, Verheggen FG, et al. Microorganisms from aphid honeydew attract and enhance the efficacy of natural enemies. Nat Commun. 2011;2:348. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/ncomms1347.

    Article  PubMed  Google Scholar 

  32. Keegan KL, Rota J, Zahiri R, Zilli A, Wahlberg N, Schmidt BC, et al. Toward a Stable Global Noctuidae (Lepidoptera) Taxonomy. Insect Syst Diver. 2021;5(3):1. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/isd/ixab005.

    Article  Google Scholar 

  33. Rabieh MM. Biodiversity of noctuid moths (Lepidoptera: Noctuidae) in the agroecosystems of Mashhad County. Biodivers Int J. 2018;2(2):147–51. https://doiorg.publicaciones.saludcastillayleon.es/10.15406/bij.2018.02.00057.

    Article  Google Scholar 

  34. El-Sayed AM, Heppelthwaite VJ, Manning LM, Gibb AR, Suckling DM. Volatile constituents of fermented sugar baits and their attraction to lepidopteran species. J Agric Food Chem. 2005;53:953–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1021/jf048521j.

    Article  PubMed  Google Scholar 

  35. Utrio P. Sugaring for moths: why are noctuids attracted more than geometrids? Ecol Entomol. 1983;8:437–45. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1365-2311.1983.tb00522.x.

    Article  Google Scholar 

  36. Tóth M, Szarukán I, Dorogi B, Gulyás A, Nagy P, Rozgonyi Z. Male and female noctuid moths attracted to synthetic lures in Europe. J Chem Ecol. 2010;36:592–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s10886-010-9789-z.

    Article  PubMed  Google Scholar 

  37. Becher PG, Hagman A, Verschut V, Chakraborty A, Rozpędowska E, Lebreton S, et al. Chemical signaling and insect attraction is a conserved trait in yeasts. Ecol Evol. 2018;8:2962–74. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/ece3.3905.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Maragatham A, Panneerselvam A. Isolation, identification and characterization of wine yeast from rotten papaya fruits for wine production. Adv Appl Sci Res. 2011;2(2):93–8. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2016.01690.

    Article  Google Scholar 

  39. Vadkertiová R, Molnárová J, Vránová D, Sláviková E. Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees. Can J Microbiol. 2012 58;1344-52. https://doiorg.publicaciones.saludcastillayleon.es/10.1139/cjm-2012-0468.

  40. Komatsuzaki N, Okumura R, Sakurai M, Ueki Y, Shima J. Characteristics of Saccharomyces cerevisiae isolated from fruits and humus: Their suitability for bread making. Prog Biol Sci. 2016;6(1):55–63. https://doiorg.publicaciones.saludcastillayleon.es/10.22059/PBS.2016.59008.

    Article  Google Scholar 

  41. Nasir A, Rahman SS, Hossain MM, Choudhury N. Isolation of Saccharomyces cerevisiae from pineapple and orange and study of metal´s effectiveness on ethanol production. Eur J Microbiol Immunol. 2017;7(1):76–91. https://doiorg.publicaciones.saludcastillayleon.es/10.1556/1886.2016.00035.

    Article  Google Scholar 

  42. Zhang DD, Hou XQ, Powell D, Löfstedt C. Female-biased expressed odorant receptor genes differentially tuned to repulsive or attractive plant volatile compounds in the turnip moths. BioRxiv: 2023,548602. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/2023.07.11.548602.

  43. Borrull A, López-Martínez G, Poblet M, Cordero-Otero R, Rozès N. New insights into the toxicity mechanism of octanoic and decanoic acids on Saccharomyces cerevisiae. Yeast. 2015;32(5):451–60. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/yea.3071.

    Article  PubMed  Google Scholar 

  44. Broach JR. Nutritional control of growth and development in yeast. Genetics. 2012;192(1):73–105. https://doiorg.publicaciones.saludcastillayleon.es/10.1534/genetics.111.135731.

    Article  PubMed  PubMed Central  Google Scholar 

  45. Landolt PJ. New chemical attractants for trapping Lacanobia subjuncta, Mamestra configurata, and Xestia cnigrum (Lepidoptera: Noctuidae). J Econ Entomol. 2000;93:101–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1603/0022-0493-93.1.101.

    Article  PubMed  Google Scholar 

  46. Landolt PJ, Alfaro JF. Trapping Lacanobia subjuncta, Xestia c-nigrum, and Mamestra configurata (Lepidoptera: Noctuidae) with acetic acid and 3-methyl-1-butanol in controlled release dispensers. Environ Entomol. 2001;30:656–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1603/0046-225X-30.4.656.

    Article  Google Scholar 

  47. Landolt PJ, Pantoja A, Hagerty A, Crabo L, Green D. Moths trapped in Alaska with feeding attractant lures and the seasonal flight patterns of potential agricultural pest. Can Entomol. 2007;139:278–91. https://doiorg.publicaciones.saludcastillayleon.es/10.4039/n06-034.

    Article  Google Scholar 

  48. Landolt PJ, Adams T, Zack RS, Crabo L. A diversity of moths (Lepidoptera) trapped with two feeding attractants. Ann Entomol Soc Am. 2011;104(3):498–506. https://doiorg.publicaciones.saludcastillayleon.es/10.1603/AN10189.

    Article  Google Scholar 

  49. Legal L, Plawecki M. Comparative sensitivity of various insects to toxic compounds from Morinda citrifolia (L). Entomol Probl. 1995;26(2):155–9.

    Google Scholar 

  50. Legal L, Moulin B, Jallon JM. The relation between structures and toxicity of oxygenated aliphatic compounds homologous to the insecticide octanoic acid and the chemotaxis of two species of Drosophila. Pestic Biochem Physiol. 1999;65(2):90–101. https://doiorg.publicaciones.saludcastillayleon.es/10.1006/pest.1999.2430.

    Article  Google Scholar 

  51. Mullens BA, Reifenrath WG, Butler SM. Laboratory trials of fatty acids as repellents or antifeedants against houseflies, horn flies and stable flies (Diptera: Muscidae). Pest Manage Sci. 2009;65(12):1360–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/ps.1823.

    Article  Google Scholar 

  52. Zhu JJ, Cermak SC, Kenar JA, Brewer G, Haynes KF, Boxler D, et al. Better than DEET repellent compounds derived from coconut oil. Sci Rep. 2018;8(1):1–12. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-018-32373-7.

    Article  Google Scholar 

  53. Kaczmarek A, Wronska A, Kazek M, Boguś MI. Octanoic acid: an insecticidal metabolite of Conidiobolus coronatus (Entomopthorales) that affects two major antifungal protection systems in Galleria mellonella (Lepidoptera): cuticular lipids and hemocytes. Int J Mol Sci. 2022;23(9):5204. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ijms23095204.

    Article  PubMed  PubMed Central  Google Scholar 

  54. de Fouchier A, Walker WB, Montagné N, Steiner C, Binyameen M, Schlyter F, et al. Functional evolution of Lepidoptera olfactory receptors revealed by deorphanization of a moth repertoire. Nat Commun. 2017;8:15709. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/ncomms15709.

    Article  PubMed  PubMed Central  Google Scholar 

  55. Bohbot JD, Jones PL, Wang G, Pitts RJ, Pask GM, Zwiebel LJ. Conservation of indole responsive odorant receptors in mosquitoes reveals an ancient olfactory trait. Chem Senses. 2011;36:149–60. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/chemse/bjq105.

    Article  PubMed  Google Scholar 

  56. Adipietro KA, Mainland JD, Matsunami H. Functional evolution of mammalian odorant receptors. PLoS Genet. 2012;8(7):e1002821. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pgen.1002821.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Gonzalez F, Bengtsson JM, Walker WB, Sousa MF, Cattaneo AM, Montagné N, et al. A conserved odorant receptor detects the same 1-indanone analogs in a tortricid and a noctuid moth. Front Ecol Evol. 2015;3:131. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fevo.2015.00131.

    Article  Google Scholar 

  58. Roberts ER, Biswas T, Yuvaraj JK, Grosse-Wilde E, Powell D, Hansson BS, et al. Odorant receptor orthologues in conifer-feeding beetles display conserved responses to ecologically relevant odours. Mol Ecol. 2022;31(13):3693–707. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/mec.16494.

    Article  PubMed  PubMed Central  Google Scholar 

  59. Prieto-Godino LL, Schmidt HR, Benton R. Molecular reconstruction of recurrent evolutionary switching in olfactory receptor specificity. eLife. 2021;22:10. https://doiorg.publicaciones.saludcastillayleon.es/10.7554/eLife.69732.

    Article  Google Scholar 

  60. Matsuo T, Sugaya S, Yasukawa J, Aigaki T, Fuyama Y. Odorant-binding proteins OBP57d and OBP57e affect taste perception and host-plant preference in Drosophila sechellia. PLoS Biol. 2007;5(5):e118. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pbio.0050118.

    Article  PubMed  PubMed Central  Google Scholar 

  61. Andrade López JM, Lanno SM, Auerbach JM, Moskowitz EC, Sligar LA, Wittkopp PJ, et al. Genetic basis of octanoic acid resistance in Drosophila sechellia: functional analysis of a fine-mapped region. Mol Ecol. 2017;26(4):1148–60. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/mec.14001.

    Article  PubMed  PubMed Central  Google Scholar 

  62. Raji JI, Melo N, Castillo JS, Gonzalez S, Saldana V, Stensmyr MC, et al. Aedes aegypti mosquitoes detect acidic volatiles found in human odor using the IR8a pathway. Curr Biol. 2019;29(8):1253–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cub.2019.02.045.

    Article  PubMed  PubMed Central  Google Scholar 

  63. de Obaldia ME, Morita T, Dedmon LC, Boehmler DJ, Jiang CS, Zeledon EV, et al. Differential mosquito attraction to humans is associated with skin-derived carboxylic acid levels. Cell. 2022;185(22):4099–116. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cell.2022.09.034.

    Article  PubMed  PubMed Central  Google Scholar 

  64. Ray G, Huff RM, Castillo JS, Bellantuono AJ, DeGennaro M, Pitts JR. Carboxylic acids that drive mosquito attraction to humans activate ionotropic receptors. PLoS Neglect Trop D. 2023;17(6):e0011402. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pntd.0011402.

    Article  Google Scholar 

  65. Chang H, Liu Y, Ai D, Jiang X, Dong S, Wang G. A pheromone antagonist regulates optimal mating time in the moth Helicoverpa armigera. Curr Biol. 2017;27(11):1610–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cub.2017.04.035.

    Article  PubMed  Google Scholar 

  66. Zhang X, Liu Y, Guo M, Sun D, Zhang M, Chu X, et al. A female-specific odorant receptor mediates oviposition deterrence in the moth Helicoverpa armigera. Curr Biol. 2024;34(1):1–11. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cub.2023.11.026.

    Article  PubMed  Google Scholar 

  67. Wu K, Gong P. A new and practical artificial diet for the cotton bollworm. Insect Sci. 2008;4(3):277–82. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/j.1744-7917.1997.tb00101.x.

    Article  Google Scholar 

  68. Forte SN, Ferrrro AA, Alonso TS. Content and composition of phosphoglycerols and neutral lipids at different developmental stages of the eggs of the codling moth, Cydia pomonella (Lepidoptera: Tortricidae). Arch Insect Biochem Physiol. 2002;50:121–30. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/arch.10036.

    Article  PubMed  Google Scholar 

  69. Liu N, Xu W, Papanicolaou A, Dong S, Anderson A. Identification and characterization of three chemosensory receptor families in the cotton bollworm Helicoverpa armigera. BMC Genomics. 2014;15(1):e597. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/1471-2164-15-597.

    Article  Google Scholar 

  70. Liu NY, Xu W, Dong SL, Zhu JY, Xu YX, Anderson A. Genome-wide analysis of ionotropic receptor gene repertoire in Lepidoptera with an emphasis on its functions of Helicoverpa armigera. Insect Biochem Mol Biol. 2018;99:37–53. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ibmb.2018.05.005.

    Article  PubMed  Google Scholar 

  71. Gouin A, Bretaudeau A, Nam K, Gimenez S, Aury JM, Duvic B, et al. Two genomes of highly polyphagous lepidopteran pests (Spodoptera frugiperda, Noctuidae) with different host-plant ranges. Sci Rep. 2017;7:11816. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-017-10461-4.

    Article  PubMed  PubMed Central  Google Scholar 

  72. Du L, Zhao X, Liang X, Gao X, Liu Y, Wang G. Identification of candidate chemosensory genes in Mythimna separata by transcriptomic analysis. BMC Genomics. 2018;19:518. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12864-018-4898-0.

    Article  PubMed  PubMed Central  Google Scholar 

  73. Tanaka K, Uda Y, Ono Y, Nakagawa T, Suwa M, Yamaoka R, et al. Highly selective tuning of a silkworm olfactory receptor to a key mulberry leaf volatile. Curr Biol. 2009;19:881–90. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cub.2009.04.035.

    Article  PubMed  Google Scholar 

  74. Croset V, Rytz R, Cummins SF, Budd A, Brawand D, Kaessmann H, et al. Ancient protostome origin of chemosensory ionotropic glutamate receptors and the evolution of insect taste and olfaction. PLoS Genet. 2010;6(8):e1001064. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pgen.1001064.

    Article  PubMed  PubMed Central  Google Scholar 

  75. Yang B, Ozaki K, Ishikawa Y, Matsuo T. Identification of candidate odorant receptors in Asian corn borer Ostrinia furnacalis. PLoS ONE. 2015;10(3):e0121261. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0121261.

    Article  PubMed  PubMed Central  Google Scholar 

  76. Bengtsson JM, Trona F, Montagne N, Anfora G, Ignell R, Witzgall P, et al. Putative chemosensory receptors of the codling moth, Cydia pomonella, identified by antennal transcriptome analysis. PLoS ONE. 2012;7(2):e31620. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0031620.

    Article  PubMed  PubMed Central  Google Scholar 

  77. Engsontia P, Sangket U, Chotigeat W, Satasook C. Molecular evolution of the odorant and gustatory receptor genes in lepidopteran insects: implications for their adaptation and speciation. J Mol Evol. 2014;79:21–39. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00239-014-9633-0.

    Article  PubMed  Google Scholar 

  78. Zhang J, Zhang F, Tay WT, Robin C, Shi Y, Guan F, et al. Population genomics provides insights into lineage divergence and local adaptation within the cotton bollworm. Mol Ecol Resour. 2022;22(5):1875–91. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1755-0998.13581.

    Article  PubMed  Google Scholar 

  79. Wang P, Jin M, Wu C, Peng Y, He Y, Wang H, et al. Population genomics of Agrotis segetum provide insights into the local adaptive evolution of agricultural pests. BMC Biol. 2024;22:42. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12915-024-01844-x.

    Article  PubMed  PubMed Central  Google Scholar 

  80. Zhang L, Liu B, Zheng W, Liu C, Zhang D, Zhao S, et al. Genetic structure and insecticide resistance characteristics of fall armyworm populations invading China. Mol Ecol Resour. 2020;20(6):1682–96. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1755-0998.13219.

    Article  PubMed  PubMed Central  Google Scholar 

  81. Zhao H, Liu H, Liu Y, Wang C, Ma B, Zhang M, et al. Chromosome-level genomes of two armyworms, Mythimna separata and Mythimna loreyi, provide insights into the biosynthesis and reception of sex pheromones. Mol Ecol Resour. 2023;23(6):1423–41. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1755-0998.13809.

    Article  PubMed  Google Scholar 

  82. Lu F, Wei Z, Luo Y, Guo H, Zhang G, Xia Q, et al. SilkDB 3.0: visualizing and exploring multiple levels of data for silkworm. Nucleic Acids Res. 2020;48(D1):D749–55. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkz919.

    Article  PubMed  Google Scholar 

  83. Fang G, Zhang Q, Cao Y, Wang Y, Qi M, Wu N, et al. The draft genome of the Asian corn borer yields insights into ecological adaptation of a devastating maize pest. Insect Biochem Mol Biol. 2021;138:103638. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ibmb.2021.103638.

    Article  PubMed  Google Scholar 

  84. Wan F, Yin C, Tang R, Chen M, Wu Q, Huang C, et al. A chromosome-level genome assembly of Cydia pomonella provides insights into chemical ecology and insecticide resistance. Nat Commun. 2019;10(1):1–14. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41467-019-12175-9.

    Article  Google Scholar 

  85. Jouraku A, Yamamoto K, Kuwazaki S, Urio M, Suetsugu Y, Narukawa J, et al. KONAGAbase: a genomic and transcriptomic database for the diamondback moth, Plutella xylostella. BMC genomics, 2013;14(1):464. https://biomedcentral-www.publicaciones.saludcastillayleon.es/1471-2164/14/464.

  86. Sharakhova MV, Hammond MP, Lobo NF, Krzywinski J, Unger MF, Hillenmeyer ME, et al. Update of the Anopheles gambiae PEST genome assembly. Genome Biol. 2007;8(1):R5. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/gb-2007-8-1-r5.

    Article  PubMed  PubMed Central  Google Scholar 

  87. Luo S, Tang M, Frandsen PB, Stewart RJ, Zhou X. The genome of an underwater architect, the caddisfly Stenopsyche tienmushanensis Hwang (Insecta: Trichoptera). GigaScience. 2018;7:1–12. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/gigascience/giy143.

    Article  PubMed  Google Scholar 

  88. Zhang DD, Löfstedt C. Functional evolution of a multigene family: orthologous and paralogous pheromone receptor genes in the turnip moth, Agrotis segetum. PLoS ONE. 2013;8(10):e77345. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0077345.

    Article  PubMed  PubMed Central  Google Scholar 

  89. Hou X, Zhang DD, Yuvaraj JK, Corcoran JA, Andersson MN, Löfstedt C. Functional characterization of odorant receptors from the moth Eriocrania semipurpurella: a comparison of results in the Xenopus oocyte and HEK cell systems. Insect Biochem Mol Biol. 2020;117:103289. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ibmb.2019.103289.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

We thank Chunyan Wang for her assistance in insect rearing. We thank Shudong Luo from the Institute of Apicultural Research of the Chinese Academy of Agricultural Sciences for proving honey.

Funding

This work was supported by grants from the National Natural Science Foundation of China (Grant No. 32202307 to X.Q.H., 32130089 to G.W.), Shenzhen Science and Technology Program (Grant No. KQTD20180411143628272 to G.W.), Special Funds for Science Technology Innovation and Industrial Development of Shenzhen Dapeng New District (Grant No. PT202101-02 to G.W.) and the China Postdoctoral Science Foundation (Grant No. 2021M703548 to X.Q.H.). The funder had no role in study design, data collection and interpretation or manuscript preparation.

Author information

Authors and Affiliations

  1. Shenzhen Branch, Guangdong Laboratory for Lingnan Modern Agriculture, Synthetic Biology Laboratory of the Ministry of Agriculture and Rural Affairs, Agricultural Genomics Institute at Shenzhen, Chinese Academy of Agricultural Sciences, Shenzhen, China

    Xiao-Qing Hou, Hanbo Zhao & Guirong Wang

  2. State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, China

    Yang Liu & Guirong Wang

  3. Department of Biology, Lund University, Lund, Sweden

    Dan-Dan Zhang & Christer Löfstedt

  4. Xianghu Laboratory, Hangzhou, Zhejiang, China

    Xiao-Qing Hou & Christer Löfstedt

Authors
  1. Xiao-Qing Hou
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Dan-Dan Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Hanbo Zhao
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Yang Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Christer Löfstedt
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Guirong Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

G.W., C.L., D.D.Z., Y.L and X.Q.H. conceived and designed the study. X.Q.H. performed the oocyte recordings, fermentation trials and behavioral assays. X.Q.H. and H.Z. performed the phylogenetic analysis. X.Q.H. analyzed the data and drafted the manuscript with contributions from all authors. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Guirong Wang.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that no competing interest exists.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

12915_2024_2102_MOESM1_ESM.docx

Additional file 1. Table S1. Amounts of isoamyl alcohol and octanoic acid emitted from 12h and 48h fermented honey solution, apple juice and watermelon juice. Table S2. Pairwise amino acid identityof receptors from HarmOR52 clade. Table S3. Pairwise amino acid identityof IR75q.1 clade. Table S4. List of compounds used in this study, with CAS number, purity and source. Table S5. Primers used in this study. Fig. S1. The volatile profiles of different sugary substrates change with fermentation process. Fig. S2. Behavioral responses of female and male moths in a Y-tube olfactometer towater and fresh juice andfresh juice and fresh juice

Additional file 2. Amino acid and nucleotide sequences of the ORs and IRs tested in oocyte recordings

Additional file 3. Individual data values for Fig. 5 and Fig. 6

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hou, XQ., Zhang, DD., Zhao, H. et al. Attraction and aversion of noctuid moths to fermented food sources coordinated by olfactory receptors from distinct gene families. BMC Biol 23, 1 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12915-024-02102-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12915-024-02102-w

Keywords

BMC Biology

ISSN: 1741-7007

Contact us