Table 2 Oligonucleotide primers used for cloning and sequencing
Primer name | Sequence (5′ → 3′) | Description |
|---|---|---|
hp1368_RT1 | AAAAGGATCCGAATATCAATAAAGTGTTTTATC | Cloning of HP1368 into pUC18 and forward primer for qPCR of HP1368 |
hp1368_RT2 | TGTGCCATTTTTTGCGTAATC | Reverse primer for RT PCR of hp1368 |
hp1368_rv | AAAAGGTACCTCAAAATCAAACAAGTTT | Cloning of HP1368 into pUC18 |
hp1368_fw2 | AAAAAGATCTCTATAGAATTTATCGGCGTG | Reverse amplification and insertion of BglII restriction site for aphA3-III cassette cloning |
hp1368_rv2 | AAAAAGATCTGTAGCTCCCAAACATCAATC | Reverse amplification and insertion of BglII restriction site for aphA3-III cassette cloning |
luxS-BamHI-fw | AAAAGGATCCGTGGAAAGTTTGGTGGGGAT | Cloning of HP0105 (luxS) and flanking regions into pUC18 |
luxS-KpnI-rv | AAAAGGTACCCTATTTTGACTTCTTTTGCAGAT | Cloning of HP0105 (luxS) and flanking regions into pUC18 |
luxS-BglII-fw2 | AAAAAGATCTTTAAACCATGACAATTACACGG | Reverse amplification and insertion of BglII restriction site for aphA3-III cassette cloning |
luxS-BglII-rv2 | AAAAAGATCTGTGTAGGCTAGGCATGTCCA | Reverse amplification and insertion of BglII restriction site for aphA3-III cassette cloning |
hp0051_RT1 | GATTTATTTTGTGGGGCTGG | Forward primer for qPCR of HP0051 (CCTC MTase) gene |
hp0051_RT2 | GCGTTTTTATGGTTGTTTTCAAA | Reverse primer for qPCR of HP0051 (CCTC MTase) gene |
hp1121_RT1 | ATTGGTGGAGGCCGTTTGG | Forward primer for qPCR of HP1121 (GCGC MTase) gene |
hp1121_RT2 | TTGATTCGCATCAAATCCCCA | reverse primer for qPCR of HP1121 (GCGC MTase) gene |
luxS-RT1 | TGGATCACACCAAAGTCAAAG | Forward primer for qPCR of HP0105 (luxS) gene |
luxS-RT2 | TAGGCTAGGCATGTCCATGT | Reverse primer for qPCR of HP0105 (luxS) gene |
feoB-RT1 | GAGCGTAATTTAGCCTTAAGC | Forward primer for qPCR of HP0687 (feoB) gene |
feoB-RT2 | TTGGCACGCACACAACCCC | Reverse primer for qPCR of HP0687 (feoB) gene |
cah-RT1 | GCTGGGACAAATTGCACAAAG | Forward primer for qPCR of HP1186 (cah) gene |
cah-RT2 | GTGAAAAAGACCGCTTTAGGTT | Reverse primer for qPCR of HP1186 (cah) gene |